The system will be going down for regular maintenance. Please save your work and logout.

Show simple item record

hal.structure.identifierBiologie du fruit et pathologie [BFP]
dc.contributor.authorCANDRESSE, Thierry
hal.structure.identifierBiologie du fruit et pathologie [BFP]
dc.contributor.authorFAURE, Chantal
hal.structure.identifierSanté et agroécologie du vignoble [UMR SAVE]
dc.contributor.authorCALONNEC, Agnes
hal.structure.identifierSanté et agroécologie du vignoble [UMR SAVE]
dc.contributor.authorCARTOLARO, Philippe
hal.structure.identifierBiologie du fruit et pathologie [BFP]
dc.contributor.authorMARAIS, Armelle
dc.date.issued2024
dc.identifier.issn0191-2917
dc.description.abstractEnVitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5’ TTACAGGTTTGATTGGAATCATG 3’ and 5’ ATAGTAGGTCCAATCACTAATC 3’ (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.
dc.language.isoen
dc.publisherAmerican Phytopathological Society
dc.subject.enVitis vinifera L
dc.subject.enCausal Agent
dc.subject.enPathogen detection
dc.subject.enSubject Areas
dc.subject.enViruses and viroids
dc.subject.engrapevine
dc.subject.enVirus cryptic virus
dc.title.enFirst report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France
dc.typeArticle de revue
dc.identifier.doi10.1094/pdis-09-23-1751-pdn
dc.subject.halSciences de l'environnement
bordeaux.journalPlant Disease
bordeaux.volume108
bordeaux.issue1
bordeaux.peerReviewedoui
hal.identifierhal-04269144
hal.version1
hal.popularnon
hal.audienceInternationale
hal.origin.linkhttps://hal.archives-ouvertes.fr//hal-04269144v1
bordeaux.COinSctx_ver=Z39.88-2004&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.jtitle=Plant%20Disease&rft.date=2024&rft.volume=108&rft.issue=1&rft.eissn=0191-2917&rft.issn=0191-2917&rft.au=CANDRESSE,%20Thierry&FAURE,%20Chantal&CALONNEC,%20Agnes&CARTOLARO,%20Philippe&MARAIS,%20Armelle&rft.genre=article


Files in this item

FilesSizeFormatView

There are no files associated with this item.

This item appears in the following Collection(s)

Show simple item record