First report of Peach-associated Luteovirus in nectarine (<em>Prunus persica</em>) in Italy.
| hal.structure.identifier | Dipartimento di Agraria | |
| dc.contributor.author | SORRENTINO, Roberto | |
| hal.structure.identifier | Biologie du fruit et pathologie [BFP] | |
| dc.contributor.author | MARAIS, Armelle | |
| hal.structure.identifier | Biologie du fruit et pathologie [BFP] | |
| dc.contributor.author | FAURE, Chantal | |
| hal.structure.identifier | Biologie du fruit et pathologie [BFP] | |
| dc.contributor.author | THEIL, Sébastien | |
| hal.structure.identifier | Department of Agricultural Sciences | |
| dc.contributor.author | ALIOTO, Daniela | |
| hal.structure.identifier | Biologie du fruit et pathologie [BFP] | |
| dc.contributor.author | CANDRESSE, Thierry | |
| dc.date.issued | 2018 | |
| dc.identifier.issn | 0191-2917 | |
| dc.description.abstractEn | Nectarines (Prunus persica) are among the most popular stone fruits grown in Italy. In particular, the Campania region produces an average of 80.000 tons of fresh fruits per year. In 2014, a survey was conducted in Eboli (Salerno province) in a five years old nectarine (cv. Gartairo) orchard in which about 30% of the trees showed an intense pitting of the fruit surface. Leaves, branches and trunk were symptomless while the intensity of the pitting tended to increase with fruit ripeness. The fruit mesocarp was not altered, nor were the flavour and taste of the fruits. To investigate the possible etiology of the disease, a symptomatic sample was analyzed by high-throughput sequencing (HTS). Double-stranded RNAs (dsRNAs) were purified by CF11 cellulose chromatography as previously described (Candresse et al., 2013) from 2-3 mm thick epicarp peel collected from a ripe fruit. The cDNA libraries were generated with the SuperScript II reverse transcriptase (Invitrogen), PCR amplified and sequenced on the Miseq Illumina platform using a 2x250bp paired-end sequencing strategy. Raw data were trimmed and cleaned by removing adaptor sequences generating a total of 1,999,750 high quality reads that were de-novo assembled with CLC Genomic Workbench 9.0, generating a total of 1663 contings. These contigs were annotated by BlastN and BlastX searches against the GenBank database, revealing the presence of several viral agents already reported as stone-fruit pathogens: Hop stunt viroid (HSVd), Apple chlorotic leaf spot virus (ACLSV) and Cherry green ring mottle virus (CGRMV). In addition, two contigs (of respectively 648 and 510 bp, totaling 0.025% of trimmed reads) showing 97% nt identity with the corresponding sequence of Peach-associated Luteovirus (PaLV) (KY635988) were also observed. To confirm the presence of PaLV and fill the sequence gap between the two contigs, total RNA was extracted and used in a RT-PCR experiment carried out with specific primers (Fw 5’ GAAACGGTAAGTCGACGGACATCGCG 3’; Rev 5’ GGAGGTTACACTGACAAGACAATGGA 3’) designed from the ends of the contigs. A PCR product of the expected size (672 pb) was obtained, purified and directly sequenced, showing 96% nt identity with the PaLV corresponding sequence. The sequence of the completed scaffold (1,609 nt), integrating the HTS data and the sequence of the 451 nt gap determined from the PCR product has been deposited in Genbank (accession number MF990276). To our knowledge, this is the first report of PaLV infecting a stone fruit tree in Italy. Members of genus Luteovirus are aphid-transmitted and phloem-limited viruses that have been recently reported to infect nectarine (Bag et al., 2015), cherry (Lenz et al., 2016) and peach (Wu et al., 2017; Igori et al., 2017). Attempts to detect PaLV in other symptomatic nectarine trees of the same orchard by RT-PCR failed, thus indicating that the virus is most probably not associated with the symptoms. Given their very recent discovery, a lot of information on the biology, symptomatology, distribution and prevalence of fruit tree-infecting luteoviruses is still missing. Further efforts to understand these agents and their potential significance are needed in order to reach scientifically-motivated decisions as to the need to control them or to exclude them from Prunus propagation materials. | |
| dc.language.iso | en | |
| dc.publisher | American Phytopathological Society | |
| dc.title.en | First report of Peach-associated Luteovirus in nectarine (<em>Prunus persica</em>) in Italy. | |
| dc.type | Article de revue | |
| dc.identifier.doi | 10.1094/PDIS-01-18-0012-PDN | |
| dc.subject.hal | Sciences du Vivant [q-bio]/Microbiologie et Parasitologie/Virologie | |
| bordeaux.journal | Plant Disease | |
| bordeaux.page | 1465-1466 | |
| bordeaux.volume | 102 | |
| bordeaux.issue | 7 | |
| bordeaux.peerReviewed | oui | |
| hal.identifier | hal-02620007 | |
| hal.version | 1 | |
| hal.popular | non | |
| hal.audience | Internationale | |
| hal.origin.link | https://hal.archives-ouvertes.fr//hal-02620007v1 | |
| bordeaux.COinS | ctx_ver=Z39.88-2004&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.jtitle=Plant%20Disease&rft.date=2018&rft.volume=102&rft.issue=7&rft.spage=1465-1466&rft.epage=1465-1466&rft.eissn=0191-2917&rft.issn=0191-2917&rft.au=SORRENTINO,%20Roberto&MARAIS,%20Armelle&FAURE,%20Chantal&THEIL,%20S%C3%A9bastien&ALIOTO,%20Daniela&rft.genre=article |
Fichier(s) constituant ce document
| Fichiers | Taille | Format | Vue |
|---|---|---|---|
|
Il n'y a pas de fichiers associés à ce document. |
|||